Top » Catalog » J1 » FGC43123

$18.00

FGC43123
[FGC43123]

FGC43123
hg38 Position: ChrY:13202058..13202058
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC43123_F AAGCAGAGGTTGCAGTGAGAC
Reverse Primer: FGC43123_R CCCCCACTTCCTACTCTTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies