Top » Catalog » J1 » FGC43124

$18.00

FGC43124
[FGC43124]

FGC43124
hg38 Position: ChrY:13640551..13640551
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: J1a
Comments: Below FGC5 > FGC1
Forward Primer: FGC43124_F TGGAAGATGAAGCCCTTGAC
Reverse Primer: FGC43124_R GAGGCAAACCTCTGAACCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies