Top » Catalog » J1 » FGC43126

$18.00

FGC43126
[FGC43126]

FGC43126
hg38 Position: ChrY:17234820..17234820
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: J1
Comments: Below Y5321 > Y5324 > Y5322 > Y9271 > Y5323 > Y5320
Forward Primer: FGC43126_F TATTCCCCAGGATGTACTGCAG
Reverse Primer: FGC43126_R GCACATCCTGCACCTGTACTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC38648
1 x A20304
1 x FGC4720
1 x A13635
1 x FGC13864
1 x FGC4358
1 x FGC14446
1 x FGC4356
1 x A15552
$162.00
Haplogroup Info
Other products
Currencies