Top » Catalog » J1 » FGC54418

$18.00

FGC54418
[FGC54418]

FGC54418
hg38 Position: ChrY:21417689..21417689
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1
Comments: Below FGC5 > FGC1 > FGC43122
Forward Primer: FGC54418_F TCAATAGAAAATAAATCATTAAAGCTATCG
Reverse Primer: FGC54418_R CCCCTCTCCCTCTGTCCTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x ALK279
1 x FGC31327
1 x FGC4761
$54.00
Haplogroup Info
Other products
Currencies