Top » Catalog » J1 » BY25901

$18.00

BY25901
[BY25901]

BY25901
hg38 Position: ChrY:11706034..11706034
Ancestral: G
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: J1a2a1a2d2b2b2c2a
Comments: .
Forward Primer: BY25901_F ATGGAATTTATTCCAAAAGATTGC
Reverse Primer: BY25901_R CGATTCCATTCTCTTCCGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC28714
$18.00
Haplogroup Info
Other products
Currencies