Top » Catalog » J1 » BY183285

$18.00

BY183285
[BY183285]

BY183285
hg38 Position: ChrY:15306741..15306741
Ancestral: A
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: BY183285_F CAAGGATATGGTTCTGCAACC
Reverse Primer: BY183285_R TTTTAACTTCATCTAAGTTCACTTCTTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x ALK597
1 x A13636
1 x A24499
1 x FGC10411
1 x A19334
1 x FGC14712
1 x FGC19188
1 x ALK3
1 x FGC15940
1 x FGC5231
1 x FGC42789
1 x FGC12860
1 x FGC31164
1 x ALK115
1 x ALK908
1 x FGC22746
1 x FGC29978
1 x FGC4245
1 x A21956
1 x FGC14706
1 x FGC5238
1 x FGC19502
1 x A19279
1 x FGC22258
$432.00
Haplogroup Info
Other products
Currencies