Top » Catalog » J1 » BY183285

$18.00

BY183285
[BY183285]

BY183285
hg38 Position: ChrY:15306741..15306741
Ancestral: A
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: BY183285_F CAAGGATATGGTTCTGCAACC
Reverse Primer: BY183285_R TTTTAACTTCATCTAAGTTCACTTCTTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC6526
$18.00
Haplogroup Info
Other products
Currencies