Top » Catalog » J1 » FGC38802

$18.00

FGC38802
[FGC38802]

FGC38802
hg38 Position: ChrY:15117157..15117157
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC38802_F AACGATCTCAAAAGCTAACAGAAAAG
Reverse Primer: FGC38802_R TTTGTTTATGTGATGGATTACATGG
Reviews

Customers who bought this product also purchased
FT157054
FT157054
FGC1696
FGC1696
ZS11060
ZS11060
FGC4316
FGC4316
FGC48131
FGC48131
FGC5
FGC5
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies