Top » Catalog » J1 » FGC38802

$18.00

FGC38802
[FGC38802]

FGC38802
hg38 Position: ChrY:15117157..15117157
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC38802_F AACGATCTCAAAAGCTAACAGAAAAG
Reverse Primer: FGC38802_R TTTGTTTATGTGATGGATTACATGG
Reviews

Customers who bought this product also purchased
ZS8277
ZS8277
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC40447
1 x FGC12857
1 x FGC37843
1 x BY32851
1 x ALK161
1 x ALK281
1 x FGC4417
1 x FGC4402
1 x A18931
1 x FGC4339
1 x A16982
1 x FGC40060
1 x ALK485
1 x A13639
1 x FGC8714
1 x FGC45522
1 x FGC16722
1 x A14638
1 x A19931
1 x A18937
1 x FGC4800
$378.00
Haplogroup Info
Other products
Currencies