Top » Catalog » J1 » FGC4737

$19.00

FGC4737
[FGC4737]

FGC4737
hg38 Position: ChrY:6884119..6884119
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-YSC234
Comments: Downstream from YSC234
Forward Primer: FGC4737_F CAATGATTTGTTCATTATGTGTCAG
Reverse Primer: FGC4737_R ACGGGCAGAACGTGTAGG
Reviews

Customers who bought this product also purchased
Z2079
Z2079
PF692
PF692
FT148741
FT148741
M284
M284
S23680
S23680
BY192065
BY192065
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies