Top » Catalog » J1 » FGC4737

$18.00

FGC4737
[FGC4737]

FGC4737
hg38 Position: ChrY:6884119..6884119
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-YSC234
Comments: Downstream from YSC234
Forward Primer: FGC4737_F CAATGATTTGTTCATTATGTGTCAG
Reverse Primer: FGC4737_R ACGGGCAGAACGTGTAGG
Reviews

Customers who bought this product also purchased
CTS11741
CTS11741
SK1296
SK1296
ZS2518
ZS2518
P58
P58
A11234
A11234
ZS5944
ZS5944
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC47834
1 x ALK877
1 x BY13768
1 x FGC4326
1 x BY108
1 x BY66740
1 x FGC22239
$126.00
Haplogroup Info
Other products
Currencies