Top » Catalog » J1 » FGC4743

$18.00

FGC4743
[FGC4743]

FGC4743
hg38 Position: ChrY:8454033..8454033
Ancestral: G
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-YSC234
Comments: Downstream from YSC234
Forward Primer: FGC4743_F GCCGCAATAAACATATGTGTTC
Reverse Primer: FGC4743_R CCCATCAAAATGTGGGTGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY67806
1 x FGC48143
1 x FGC4430
1 x FGC4792
1 x A22924
1 x FGC42773
1 x ALK431
1 x FGC7379
1 x FGC4738
1 x ALK473
1 x FGC5229
1 x A13637
1 x ALK609
1 x FGC8216
1 x FGC1718
$270.00
Haplogroup Info
Other products
Currencies