Top » Catalog » J1 » FGC9583

$18.00

FGC9583
[FGC9583]

FGC9583
hg38 Position: ChrY:12853824..12853824
Ancestral: A
Derived: G
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1
Comments: Below P58 > FGC11 > Y12361
Forward Primer: FGC9583_F CCATCTTCTGCATCAATCACAG
Reverse Primer: FGC9583_R TTTCAGGCAGAATTAGGCAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC34532
1 x FGC13889
1 x FGC17476
1 x FGC50846
1 x A17834
1 x FGC45005
1 x FGC4487
1 x FGC4411
1 x FGC7620
1 x ALK248
1 x FGC9585
1 x CTS3041
1 x FGC41257
$234.00
Haplogroup Info
Other products
Currencies