Top » Catalog » J1 » FGC4768

$18.00

FGC4768
[FGC4768]

FGC4768
hg38 Position: ChrY:14268026..14268026
Ancestral: C
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-YSC234
Comments: Downstream from YSC234
Forward Primer: FGC4768_F TGGCTGGGTTGAATGGTG
Reverse Primer: FGC4768_R GGAGAAAATTTTTGCAACTTACG
Reviews

Customers who bought this product also purchased
FGC4781
FGC4781
FGC4785
FGC4785
FGC4756
FGC4756
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A20305
1 x BY4145
1 x FGC34530
1 x ALK90
1 x FGC22253
1 x BY14465
1 x FGC10417
1 x FGC4785
1 x BY154903
1 x FGC4716
1 x FGC4316
1 x BY67
1 x BY79
1 x A23642
1 x FGC12836
1 x FGC31333
1 x ALK402
1 x FGC15199
1 x BY205275
1 x A14639
1 x BY80
1 x FGC41887
1 x A18939
1 x FGC17490
1 x ALK726
1 x BY3
1 x A19275
1 x FGC20898
1 x FGC7984
1 x BY182108
1 x FGC43128
1 x FGC30612
$576.00
Haplogroup Info
Other products
Currencies