Top » Catalog » J1 » FGC4792

$18.00

FGC4792
[FGC4792]

FGC4792
hg38 Position: ChrY:19727659..19727659
Ancestral: ins
Derived: del
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: .
Forward Primer: FGC4792_F TTCCCATACATGTTGTTCAAAG
Reverse Primer: FGC4792_R AATTCTTTTGCTGCTGTTGTC
Reviews

Customers who bought this product also purchased
FGC4737
FGC4737
FGC4751
FGC4751
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A12919
1 x A13638
1 x FGC22257
1 x FGC1
1 x A17829
1 x FGC4493
1 x B233
1 x BY169067
1 x CTS7188
1 x FGC33172
1 x A19929
1 x BY13788
1 x FGC49261
1 x ALK576
1 x FGC23315
$270.00
Haplogroup Info
Other products
Currencies