Top » Catalog » J1 » FGC4792

$18.00

FGC4792
[FGC4792]

FGC4792
hg38 Position: ChrY:19727659..19727659
Ancestral: ins
Derived: del
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: .
Forward Primer: FGC4792_F TTCCCATACATGTTGTTCAAAG
Reverse Primer: FGC4792_R AATTCTTTTGCTGCTGTTGTC
Reviews

Customers who bought this product also purchased
FGC4751
FGC4751
FGC4737
FGC4737
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC4385
$18.00
Haplogroup Info
Other products
Currencies