Top » Catalog » J1 » FGC4805

$18.00

FGC4805
[FGC4805]

FGC4805
hg38 Position: ChrY:13924382..13924382
Ancestral: ins
Derived: del
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: .
Forward Primer: FGC4805_F AAGACATAAGTATTGAAGACTACAATTCG
Reverse Primer: FGC4805_R TGTAAAATTGAATAGAACCAGGTACATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x ALK3
$18.00
Haplogroup Info
Other products
Currencies