Top » Catalog » J1 » BY169067

$18.00

BY169067
[BY169067]

BY169067
hg38 Position: ChrY:4402834..4402834
Ancestral: T
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: J1
Comments: Below ZS7528 > ALK198
Forward Primer: BY169067_F TCTTCTAAGGTGAAGAATAAGTTGCC
Reverse Primer: BY169067_R AAGCATGTGCCACCATGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC22728
1 x FGC4455
1 x FGC8810
1 x FGC29980
1 x ALK312
1 x ALK30
1 x FGC4708
1 x FGC7832
1 x A14650
1 x A22143
1 x ALK722
1 x FGC9587
$216.00
Haplogroup Info
Other products
Currencies