Top » Catalog » J1 » BY169067

$18.00

BY169067
[BY169067]

BY169067
hg38 Position: ChrY:4402834..4402834
Ancestral: T
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: J1
Comments: Below ZS7528 > ALK198
Forward Primer: BY169067_F TCTTCTAAGGTGAAGAATAAGTTGCC
Reverse Primer: BY169067_R AAGCATGTGCCACCATGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x B238
1 x FGC40444
1 x FGC5235
$54.00
Haplogroup Info
Other products
Currencies