Top » Catalog » J1 » A24499

$18.00

A24499
[A24499]

A24499
hg38 Position: ChrY:9572565..9572565
Ancestral: T
Derived: C
Reference: YSEQ (2019)
ISOGG Haplogroup: J1
Comments: Below Z643 > Y45046
Forward Primer: A24499_F AATGTTGAATATTGGCTCCCAG
Reverse Primer: A24499_R GGCTAACTACAATAACCAATGCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY67806
1 x FGC48143
1 x FGC4430
1 x FGC4792
1 x A22924
1 x FGC42773
1 x ALK431
1 x FGC7379
1 x FGC4738
$162.00
Haplogroup Info
Other products
Currencies