Top » Catalog » J1 » FGC51929

$18.00

FGC51929
[FGC51929]

FGC51929
hg38 Position: ChrY:12923812..12923812
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC51929_F GGATTAGCTGTCCCTTGATTGAG
Reverse Primer: FGC51929_R TACTTTGGAATCAGATCCTGATGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies