Top » Catalog » J1 » BY111515

$18.00

BY111515
[BY111515]

BY111515
hg38 Position: ChrY:14858148..14858148
Ancestral: C
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: J1
Comments: Below BY143810 > BY111515
Forward Primer: BY111515_F CCCCTGAAATTCCAACTCTG
Reverse Primer: BY111515_R TACAGGTGTGCGTAGCCATC
Reviews

Customers who bought this product also purchased
BY172178
BY172178
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies