Top » Catalog » J1 » ALK90

$18.00

ALK90
[ALK90]

ALK90
hg38 Position: ChrY:22214346..22214346
Ancestral: T
Derived: C
Reference: Ahmad Al Khuraiji (2017)
ISOGG Haplogroup: J1a
Comments: Below FGC1713 > ZS5801 > A17831
Forward Primer: ALK90_F TTTAATTGCAATTTAAATTCTTAATTGC
Reverse Primer: ALK90_R ATCATGAGGTCAAGAGATCAAGGT
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC47437
1 x CTS11741
1 x FGC5205
1 x FGC42828
1 x A18933
1 x ALK396
1 x BY74
1 x CTS15
1 x FGC17478
1 x ALK199
1 x A18075
1 x A22248
1 x FGC39467
1 x B238
1 x ALK395
1 x FGC30416
1 x FGC16640
1 x FGC4768
1 x FGC31135
1 x FGC22745
1 x FGC6095
1 x FGC12862
$396.00
Haplogroup Info
Other products
Currencies