Top » Catalog » J1 » ALK90

$18.00

ALK90
[ALK90]

ALK90
hg38 Position: ChrY:22214346..22214346
Ancestral: T
Derived: C
Reference: Ahmad Al Khuraiji (2017)
ISOGG Haplogroup: J1a
Comments: Below FGC1713 > ZS5801 > A17831
Forward Primer: ALK90_F TTTAATTGCAATTTAAATTCTTAATTGC
Reverse Primer: ALK90_R ATCATGAGGTCAAGAGATCAAGGT
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC4787
1 x ALK620
$36.00
Haplogroup Info
Other products
Currencies