Top » Catalog » J1 » BY152331

$18.00

BY152331
[BY152331]

BY152331
hg38 Position: ChrY:2978623..2978623
Ancestral: A
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: BY152331_F CAGGTATAATTTACCGAGAAGTGGAAG
Reverse Primer: BY152331_R ATGAATTTTTTAAAGCTTGTGTTCTGAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y95145
1 x Z13127
1 x Z8035
$54.00
Haplogroup Info
Other products
Currencies