Top » Catalog » J1 » BY152331

$18.00

BY152331
[BY152331]

BY152331
hg38 Position: ChrY:2978623..2978623
Ancestral: A
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: BY152331_F CAGGTATAATTTACCGAGAAGTGGAAG
Reverse Primer: BY152331_R ATGAATTTTTTAAAGCTTGTGTTCTGAAC
Reviews

Customers who bought this product also purchased
BY154830
BY154830
BY152652
BY152652
BY155375
BY155375
BY154903
BY154903
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x ALK392
1 x FGC12
1 x ALK886
1 x FGC7381
$72.00
Haplogroup Info
Other products
Currencies