Top » Catalog » J1 » BY152331

$18.00

BY152331
[BY152331]

BY152331
hg38 Position: ChrY:2978623..2978623
Ancestral: A
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: BY152331_F CAGGTATAATTTACCGAGAAGTGGAAG
Reverse Primer: BY152331_R ATGAATTTTTTAAAGCTTGTGTTCTGAAC
Reviews

Customers who bought this product also purchased
FGC1695
FGC1695
L858
L858
FGC48131
FGC48131
FGC4453
FGC4453
FGC1696
FGC1696
FGC40709
FGC40709
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies