Top » Catalog » J1 » BY154830

$18.00

BY154830
[BY154830]

BY154830
hg38 Position: ChrY:17094216..17094216
Ancestral: G
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: BY154830_F TCTTGCAATTCAGTTCTGACACTG
Reverse Primer: BY154830_R GAGTTTGGAGAGTTTCTGGATGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC34532
1 x FGC13889
1 x FGC17476
1 x FGC50846
1 x A17834
1 x FGC45005
1 x FGC4487
1 x FGC4411
1 x FGC7620
1 x ALK248
1 x FGC9585
1 x CTS3041
1 x FGC41257
$234.00
Haplogroup Info
Other products
Currencies