Top » Catalog » J1 » BY154830

$18.00

BY154830
[BY154830]

BY154830
hg38 Position: ChrY:17094216..17094216
Ancestral: G
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: BY154830_F TCTTGCAATTCAGTTCTGACACTG
Reverse Primer: BY154830_R GAGTTTGGAGAGTTTCTGGATGAG
Reviews

Customers who bought this product also purchased
BY155375
BY155375
BY154903
BY154903
BY152652
BY152652
BY152331
BY152331
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies