Top » Catalog » J1 » BY155375

$18.00

BY155375
[BY155375]

BY155375
hg38 Position: ChrY:20436682..20436682
Ancestral: C
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: BY155375_F TGCAGAAATGAATTATCACAGCTACAG
Reverse Primer: BY155375_R TTTTTAATTTGATTAACTGTGATTTTGAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x ALK620
1 x FGC42794
1 x FGC29863
1 x FGC20864
1 x FGC7982
1 x FGC12858
1 x ALK6
1 x FGC4423
1 x ALK365
1 x FGC19503
1 x FGC15177
1 x BY4061
1 x BY2
1 x FGC5423
1 x ALK909
1 x FGC48156
1 x A14644
1 x FGC48148
$324.00
Haplogroup Info
Other products
Currencies