Top » Catalog » J1 » BY155375

$18.00

BY155375
[BY155375]

BY155375
hg38 Position: ChrY:20436682..20436682
Ancestral: C
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: BY155375_F TGCAGAAATGAATTATCACAGCTACAG
Reverse Primer: BY155375_R TTTTTAATTTGATTAACTGTGATTTTGAGG
Reviews

Customers who bought this product also purchased
BY152331
BY152331
BY154903
BY154903
BY154830
BY154830
BY152652
BY152652
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies