Top » Catalog » J1 » BY155375

$18.00

BY155375
[BY155375]

BY155375
hg38 Position: ChrY:20436682..20436682
Ancestral: C
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: BY155375_F TGCAGAAATGAATTATCACAGCTACAG
Reverse Primer: BY155375_R TTTTTAATTTGATTAACTGTGATTTTGAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies