Top » Catalog » J1 » FGC48131

$18.00

FGC48131
[FGC48131]

FGC48131
hg38 Position: ChrY:19727957..19727957
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC48131_F AAAAGAAGTATGAGCAGAAAAAGG
Reverse Primer: FGC48131_R GCAAGTTTTCTTGATGTGTGG
Reviews

Customers who bought this product also purchased
FGC4243
FGC4243
FGC38802
FGC38802
FGC1696
FGC1696
ZS11060
ZS11060
FGC4316
FGC4316
FT157054
FT157054
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies