Top » Catalog » J1 » FGC48131

$18.00

FGC48131
[FGC48131]

FGC48131
hg38 Position: ChrY:19727957..19727957
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC48131_F AAAAGAAGTATGAGCAGAAAAAGG
Reverse Primer: FGC48131_R GCAAGTTTTCTTGATGTGTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY67806
1 x FGC48143
1 x FGC4430
1 x FGC4792
1 x A22924
1 x FGC42773
1 x ALK431
$126.00
Haplogroup Info
Other products
Currencies