Top » Catalog » J1 » FGC48131

$18.00

FGC48131
[FGC48131]

FGC48131
hg38 Position: ChrY:19727957..19727957
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC48131_F AAAAGAAGTATGAGCAGAAAAAGG
Reverse Primer: FGC48131_R GCAAGTTTTCTTGATGTGTGG
Reviews

Customers who bought this product also purchased
FGC7936
FGC7936
ZS4756
ZS4756
L858
L858
FT43969
FT43969
FGC7
FGC7
ZS4753
ZS4753
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies