Top » Catalog » J1 » BY181155

$18.00

BY181155
[BY181155]

BY181155
hg38 Position: ChrY:7683745..7683745
Ancestral: G
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: BY181155_F GTGTTGATTAGCTGGATGTATCCAG
Reverse Primer: BY181155_R CTCCCACCTCAGCCTCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC10416
1 x FGC6525
1 x FGC38711
1 x FGC10422
1 x FGC4338
1 x BY145
1 x A18553
1 x FGC1722
1 x FGC23929
1 x FGC5428
1 x FGC22248
1 x FGC8716
1 x FGC19506
1 x FGC1701
1 x FGC8726
1 x FGC16654
1 x A13632
1 x FGC23369
1 x FGC4465
1 x ALK480
1 x FGC22238
1 x ALK709
1 x ALK179
$414.00
Haplogroup Info
Other products
Currencies