Top » Catalog » J1 » BY181722

$18.00

BY181722
[BY181722]

BY181722
hg38 Position: ChrY:14686220..14686220
Ancestral: C
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: BY181722_F AACATGCCAACAATGTTATGGAC
Reverse Primer: BY181722_R AGTAGGGCACAATCTCTACCCTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies