Top » Catalog » J1 » ALK263

$18.00

ALK263
[ALK263]

ALK263
hg38 Position: ChrY:15767458..15767458
Ancestral: G
Derived: T
Reference: Ahmad Al Khuraiji (2018)
ISOGG Haplogroup: J1a
Comments: Below FGC1696
Forward Primer: ALK263_F CCAATAAAAGTCAAGGGAAGCG
Reverse Primer: ALK263_R GTGTGACAAATTTACTGTACCAGTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies