Top » Catalog » J1 » BY68

$18.00

BY68
[BY68]

BY68
hg38 Position: ChrY:12217578..12217578
Ancestral: G
Derived: A
Reference: FTDNA
ISOGG Haplogroup: J1 (not listed)
Comments: Aka FGC13880
Forward Primer: BY68_F CAGTTCTCATTTCTCCCATGC
Reverse Primer: BY68_R GCCCTGCACAGAGGATAAAC
Reviews

Customers who bought this product also purchased
FGC1695
FGC1695
ZS11214
ZS11214
ZS10444
ZS10444
Z18271
Z18271
Y13968
Y13968
FGC4745
FGC4745
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies