Top » Catalog » J1 » FGC17476

$18.00

FGC17476
[FGC17476]

FGC17476
hg38 Position: ChrY:2894269..2894269
Ancestral: T
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: J1c (not listed)
Comments: Below ZS227 > FGC13864 Aka BY67
Forward Primer: FGC17476_F CAATAATACTGTTTCTGATGTTTGTGC
Reverse Primer: FGC17476_R AAACTGAGAATTCAGTATGTAGCAAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC10492
1 x FGC6538
1 x BY183285
1 x A17833
1 x FGC28714
1 x FGC4351
1 x ALK897
1 x A23679
1 x ALK106
1 x FGC39173
$180.00
Haplogroup Info
Other products
Currencies