Top » Catalog » J1 » FGC8810

$18.00

FGC8810
[FGC8810]

FGC8810
hg38 Position: ChrY:16102014..16102014
Ancestral: T
Derived: G
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1c3d2
Comments: Downstream L222 > FGC1721
Forward Primer: FGC8810_F TTTGAGGGACTGGGGATTC
Reverse Primer: FGC8810_R AGGCAAGTTTCAAGCAGTCC
Reviews

Customers who bought this product also purchased
Z18215
Z18215
M267
M267
ZS8332
ZS8332
ZS8399
ZS8399
ZS12540
ZS12540
ZS8395
ZS8395
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC42685
1 x FGC20888
1 x BY38100
1 x FGC42781
1 x A19217
1 x FGC16721
1 x FGC4452
1 x ALK253
1 x FGC48180
1 x FGC4243
1 x FGC31327
1 x ALK29
1 x FGC20883
1 x FGC5206
1 x FGC16723
$270.00
Haplogroup Info
Other products
Currencies