Top » Catalog » J1 » FGC22725

$18.00

FGC22725
[FGC22725]

FGC22725
hg38 Position: ChrY:16686698..16686698
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: .
Forward Primer: FGC22725_F TCCTTGACACATACACCCTGTG
Reverse Primer: FGC22725_R AAGGCCTTTTCTGCCTCTG
Reviews

Customers who bought this product also purchased
FGC22735
FGC22735
FGC22728
FGC22728
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A18932
1 x FGC5
1 x A22918
1 x ALK341
$72.00
Haplogroup Info
Other products
Currencies