Top » Catalog » J1 » FGC22728

$18.00

FGC22728
[FGC22728]

FGC22728
hg38 Position: ChrY:21036854..21036854
Ancestral: T
Derived: G
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: .
Forward Primer: FGC22728_F AGATCTTGTGGTAAGGGCTGAC
Reverse Primer: FGC22728_R CAAAGTTTATCAGTCCTCCAAGG
Reviews

Customers who bought this product also purchased
FGC22725
FGC22725
FGC22735
FGC22735
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC34532
1 x FGC13889
1 x FGC17476
1 x FGC50846
1 x A17834
1 x FGC45005
1 x FGC4487
1 x FGC4411
$144.00
Haplogroup Info
Other products
Currencies