Top » Catalog » J1 » FGC22735

$18.00

FGC22735
[FGC22735]

FGC22735
hg38 Position: ChrY:26591234..26591234
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: .
Forward Primer: FGC22735_F CCCAGCCAGGTGACAACA
Reverse Primer: FGC22735_R GATGAAATTGTGTAACGACACATTC
Reviews

Customers who bought this product also purchased
FGC22728
FGC22728
FGC22725
FGC22725
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC50904
1 x FGC8729
1 x BY40604
1 x FGC49174
1 x ALK486
1 x A19294
1 x FGC5429
1 x FGC22744
1 x A13648
1 x A20307
$180.00
Haplogroup Info
Other products
Currencies