Top » Catalog » J1 » FGC22735

$18.00

FGC22735
[FGC22735]

FGC22735
hg38 Position: ChrY:26591234..26591234
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: .
Forward Primer: FGC22735_F CCCAGCCAGGTGACAACA
Reverse Primer: FGC22735_R GATGAAATTGTGTAACGACACATTC
Reviews

Customers who bought this product also purchased
FGC22728
FGC22728
FGC22725
FGC22725
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies