Top » Catalog » J1 » FGC5

$18.00

FGC5
[FGC5]

FGC5
hg38 Position: ChrY:16101147..16101147
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a2b2a~
Comments: Downstream of J1-FGC1696
Forward Primer: FGC5_F GGCCAAACTTTGAAATCTCC
Reverse Primer: FGC5_R GTGGGTGAACTTGAAAGCAG
Reviews

Customers who bought this product also purchased
BY40741
BY40741
FGC50010
FGC50010
ZS10295
ZS10295
ZS4760
ZS4760
ZS9483
ZS9483
FGC51963
FGC51963
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC22728
1 x FGC4455
1 x FGC8810
1 x FGC29980
1 x ALK312
1 x ALK30
1 x FGC4708
1 x FGC7832
1 x A14650
1 x A22143
1 x ALK722
1 x FGC9587
1 x FGC48094
1 x FGC4289
$252.00
Haplogroup Info
Other products
Currencies