Top » Catalog » J1 » FGC7

$18.00

FGC7
[FGC7]

FGC7
hg38 Position: ChrY:2913359..2913359
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a2b2a~
Comments: .
Forward Primer: FGC7_F CCTCATGGTAACCACAATGC
Reverse Primer: FGC7_R TCTCCCACTTGTTTGTTTTCAG
Reviews

Customers who bought this product also purchased
ZS4760
ZS4760
ZS9483
ZS9483
FGC51963
FGC51963
ZS11753
ZS11753
ZS7229
ZS7229
FGC10572
FGC10572
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x ALK392
1 x FGC4451
1 x FGC4292
1 x FGC39179
1 x FGC22747
1 x FGC34247
1 x F4320
1 x CTS9501
1 x FGC40451
1 x FGC42458
1 x BY148572
1 x FGC48150
1 x FGC8224
1 x FGC49889
1 x FGC22259
1 x FGC39175
1 x FGC17483
1 x CTS8308
1 x ALK136
1 x A12920
1 x FGC4726
$378.00
Haplogroup Info
Other products
Currencies