Top » Catalog » J1 » FGC7

$18.00

FGC7
[FGC7]

FGC7
hg38 Position: ChrY:2913359..2913359
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a2b2a~
Comments: .
Forward Primer: FGC7_F CCTCATGGTAACCACAATGC
Reverse Primer: FGC7_R TCTCCCACTTGTTTGTTTTCAG
Reviews

Customers who bought this product also purchased
FGC38802
FGC38802
FT157054
FT157054
FGC48131
FGC48131
ZS8273
ZS8273
FT43969
FT43969
FT43313
FT43313
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies