Top » Catalog » J1 » A26727

$19.00

A26727
[A26727]

A26727
hg38 Position: ChrY:13505471..13505471
Ancestral: C
Derived: T
Reference: YSEQ (2020)
ISOGG Haplogroup: J1
Comments: Below Z643 > ZS1297 > Y126240
Forward Primer: A26727_F TGAATGTAAATGGCTTAAATGCTATG
Reverse Primer: A26727_R TCTGTAAATATCTGCTAAGTCAATTTCC
Reviews

Customers who bought this product also purchased
A26725
A26725
A26730
A26730
A26728
A26728
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies