Top » Catalog » J1 » FGC34531

$18.00

FGC34531
[FGC34531]

FGC34531
hg38 Position: ChrY:8065042..8065042
Ancestral: G
Derived: T
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: J1 (not listed)
Comments: .
Forward Primer: FGC34531_F ACTCTTCTGCAAGGGTCCTG
Reverse Primer: FGC34531_R CAAGGTACAAGCAGGTTTGC
Reviews

Customers who bought this product also purchased
FGC34530
FGC34530
ZS5809
ZS5809
FGC34532
FGC34532
FGC34537
FGC34537
FGC34536
FGC34536
FGC34535
FGC34535
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC50904
1 x FGC8729
1 x BY40604
1 x FGC49174
1 x ALK486
1 x A19294
1 x FGC5429
1 x FGC22744
1 x A13648
1 x A20307
1 x FGC11
1 x FGC4278
1 x FGC4353
1 x FGC6035
1 x FGC34534
1 x A16980
1 x FGC8807
$306.00
Haplogroup Info
Other products
Currencies