Top » Catalog » J1 » FGC34535

$18.00

FGC34535
[FGC34535]

FGC34535
hg38 Position: ChrY:13456310..13456310
Ancestral: G
Derived: C
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: J1 (not listed)
Comments: .
Forward Primer: FGC34535_F AAAGACTTCCAGGGGTAGGG
Reverse Primer: FGC34535_R CTGAGGCTGGCTTTGAACTC
Reviews

Customers who bought this product also purchased
FGC34537
FGC34537
FGC34536
FGC34536
FGC34534
FGC34534
FGC34532
FGC34532
FGC34531
FGC34531
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x ALK477
1 x FGC48147
1 x BY63983
1 x FGC34537
1 x A15549
1 x CTS4352
1 x FGC42836
1 x FGC37534
1 x ALK1
1 x FGC4742
1 x FGC4279
1 x ALK272
1 x FGC35893
1 x FGC37540
1 x FGC48151
1 x BY8
1 x A13646
1 x A11234
$324.00
Haplogroup Info
Other products
Currencies