Top » Catalog » J1 » FGC34536

$18.00

FGC34536
[FGC34536]

FGC34536
hg38 Position: ChrY:15102256..15102256
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: J1 (not listed)
Comments: .
Forward Primer: FGC34536v2_F CAACTAGGCAGGAAATCATGTG
Reverse Primer: FGC34536v2_R CAGTTTTGTTCTGCAACTAGCTCTAG
Reviews

Customers who bought this product also purchased
FGC34534
FGC34534
FGC34532
FGC34532
FGC34531
FGC34531
FGC34537
FGC34537
FGC34535
FGC34535
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies