Top » Catalog » J1 » FGC34537

$18.00

FGC34537
[FGC34537]

FGC34537
hg38 Position: ChrY:17184989..17184989
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: J1 (not listed)
Comments: .
Forward Primer: FGC34537_F GCTGAGCACAAGGCCTAGTC
Reverse Primer: FGC34537_R GTCAGGTCCCCTTCCACG
Reviews

Customers who bought this product also purchased
FGC34531
FGC34531
FGC34536
FGC34536
FGC34535
FGC34535
FGC34534
FGC34534
FGC34532
FGC34532
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19335
1 x ALK279
1 x FGC4739
1 x FGC31322
1 x BY14469
1 x ALK213
1 x FGC29873
1 x FGC5441
1 x FGC5434
1 x FGC1721
1 x FGC10413
1 x FGC4416
1 x FGC4486
1 x FGC4787
1 x ALK246
1 x FGC4240
1 x BY181722
1 x FGC5479
$324.00
Haplogroup Info
Other products
Currencies