Top » Catalog » J1 » FGC4340

$18.00

FGC4340
[FGC4340]

FGC4340
hg38 Position: ChrY:8273722..8273722
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a (not listed)
Comments: Aka Y8960. Below FGC6 > FGC4336
Forward Primer: FGC4340_F CTCCTAAAATGAACACGTCTTTCC
Reverse Primer: FGC4340_R AATCACTAATGTGACTAATCACTGTGAG
Reviews

Customers who bought this product also purchased
FGC51963
FGC51963
FGC1696
FGC1696
ZS11753
ZS11753
FGC1695
FGC1695
ZS7229
ZS7229
FGC4316
FGC4316
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x ALK6
$18.00
Haplogroup Info
Other products
Currencies