Top » Catalog » J1 » FGC22238

$18.00

FGC22238
[FGC22238]

FGC22238
hg38 Position: ChrY:13406299..13406299
Ancestral: C
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Aka ZS4717. Below FGC1716
Forward Primer: FGC22238_F CAGATAGGGACTGCTGGTCTG
Reverse Primer: FGC22238_R GGCATCATTCCTATGTTCAAAAC
Reviews

Customers who bought this product also purchased
DYS533
DYS533
FGC1703
FGC1703
DYS464
DYS464
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x F1544
1 x FGC2
1 x ALK620
1 x BY145
$72.00
Haplogroup Info
Other products
Currencies